Nice work with your analysis Oscar. Try to include captions on your images. Captions are an efficient way of telling the viewer what you have done. Also, where exactly are you with virtual work? Thank you. -Max 10/21/13
RpFabG Enzyme Assays (10-15-13)
Enzyme assays were again performed using the newly made protein. The first assay was done and enzyme was continuously added until a significant decrease in absorbance was seen. This happened at about 400uL of enzyme, so this was done multiple times to ensure the reproducibility of the results. Each time, a relatively constant decrease was seen in the absorbance after the enzyme was added. This interval was then used to determine the slopes of each of these reactions. These slopes further proved that the results were reproducible. Next the Km values for both the NADPH and AAC will be obtained for inhibition assay purposes.
RpFabG Enzyme Assays (10-11-13)
In this round of assays, the concentration of all the components were changed to see if any combination gave a good read. The fifth assay shows that there is a small decrease in the absorbance so for the sixth assay an extreme amount of enzyme was added, and it showed to have worked as it showed a decrease in the absorbance. However, in the process all of the RpFabG protein that was stored in glycerol was used up leaving only -80 degree frozen protein. The seventh assay shows that the frozen protein was not functional hinting that that is not a proper storage condition for this protein. Furthermore, more RpFabG was made through expression and was purified and all of the sample was stored in glycerol.
Weeks 5 and 6
Great analysis but try to include a caption under your data as well. They may not be as long and elaborate as an analysis but they are simple and get quick important information across. Keep up the great work. Thank you. -Max 10/07/2013
RpFabG Enzyme Assays (10-5-13)
Since a relatively pure sample of protein was obtained from the previous expression and purification round, enzyme assays were conducted using the RpFabG protein. Two substrates were used, NADPH and ethylacetoacetate sodium salt (EAA). A 2xbuffer was also made for the assays in order to maintain the enzyme at proper functional conditions, the same buffer that was used for FPLC was made except that all the concentrations were doubled. Five assays were ran, each one was basically done the same way, first water and buffer was added, then NADPH, then RpFabG enzyme and then EAA. When the NADPH was added the absorbance was measured at 340 nm and more NADPH was added until the absorbance was between 1.0 and 1.5. Once the NADPH was added, the enzyme was added and the abs. monitored. When it stopped fluctuating, the EAA was added. The whole reaction was typically monitored every 10 seconds for about 20 minutes. In the assays where the absorbance did not change after the enzyme was added, more enzyme was added. Each assay had different results. The analyzes is still pending as to determine if the enzyme is functional or not.
Purification Using an Imidazole Concentration Gradient (10-3-13)
Since FPLC was not working effectively to purify the RpFabG protein, a different method was again attempted to purify the protein. This time a gradient of increasing imidazole concentration was used to slowly collect the protein and reduce the contamination of other proteins. Nine elutions were collected and nanodropped to determine the concentration of protein in each. The chart bellow shows the concentration of the nine samples. After this the samples were ran on a page gel that showed that the samples were pure enough to attempt enzyme assays using the protein. Hence the samples were pooled together and concentrated to about 2 mL of volume, the sample was then nanodropped to determine the collective concentration of the sample. The protein was then stored in the -80 and -20 freezers.
FPLC of RpFabG Round (9-28-13)
After the two samples of RpFabG were combined and purified, they were reconcentrated in order to FPLC. The sample was then taken to the FPLC and ran. The graph showed no significant peaks indicating that there wasn't protein in the sample. The small peak around 125 minutes is not significant enough to use. Alternate methods will again be attempted.
RpFabG Expression and Purification (9-28-13)
More RpFabG was expressed so that more trials of purification could be attempted. This time a new protocol was followed, growing the culture for 24 hours instead of 4 hours. Two liters were also made on this round, all samples were sonicated and stored in the -20 freezer. Two of the samples were combined and purified. The elutions were then nanodropped and reconcentrated for FPLC purposes.
Weeks 3 and 4
Oscar - include your week 4 FPLC images. Its important to document failure! Dr. B 100113
Purification of RpFabG with TEV
After the TEV had been purified, it was placed with the previously purified RpFabG protein and buffer exchange through dialysis was performed. After this, the sample was purified yet again using a Ni column and then the samples were nanodropped.
Figure 4. Once the TEV was ready for usage, it was placed in the dialysis cassette overnight with the RpFabG protein, from the previous purification round, for the buffer exchange. The next day, the cleaved protein was purified for a third time using a Ni column and the samples were nanodropped to determine the concentration and purity of each. Since TEV cleaves off the His-tag on proteins, it would hinder the Ni to attach to RpFabG hence causing it to flow through into the waste container in purification. The wash from the second purification is shown above. The concentration was 0.16 mg/mL and the 260/280 value was 2.02.
TEV Expression, Purification and Characterization
Since purification through FPLC did not function effectively, purification using TEV protease was used to cleave the His-tag off of the RpFabG protein, hence when the protein passes through the Ni column it will flow through and other contaminating protein will be retained. The results of the concentration after the purification of TEV is shown bellow.
Figure 3. TEV was made for the use of purifying the RpFabG protein. TEV was expressed and purified and the nanodrop of the samples were collected. The nanodrop of the first elution is shown above. The concentration was 0.91 mg/mL and the 260/280 value was 1.86.
Purification of RpFabG
Since more rounds of purification will have to be performed, more RpFabG was expressed and purified. This time though, the sample was passed through the Ni-NTA column twice in order to increase the chances of eliminating contamination. The results were then nanodropped to determine the concentration of the samples.
Figure 2. As previously stated, this sample of RpFabG was purified twice, this is the nanodrop of the first elution from the second round of purification. The concentration was 0.43 mg/mL and the 260/280 value was 2.16.
FPLC of RpFabG- Round 3
Anther round of FPLC was performed on the sample since a peak in UV has yet to appear. A sample of RpFabG protein was used and the results are shown below. Again, the FPLC failed to produce significant results. At this point, alternate methods of purification will be explored.
Figure 1. A third round of FPLC was performed on more RpFabG sample. The resulting graph is shown above. Yet again, the solid blue line depicting the UV reading, shows no significant peak indicating a lack of purified protein yet again.
Week 1 & 2
Oscar - good work. Dr. B 090913
FPLC of RpFabG-Round 2 (9-7-2013)
Since the first FPLC failed to give good results, another FPLC was conducted on the sample from elution #1. Everything was done according to protocol. The results are shown bellow. The graph shows no significant peaks so no protein was collected. Another round of expression, purification, characterization and FPLC will have to be done in order to obtain the protein.
Figure 6. The graph shows no noticeable peak in the UV line, indicating that there was no protein. No samples were collected.
Figure 5. Elution #1 was nanodropped to determine the concentration of the protein. It was found that it was 0.87 mg/mL and the absorbance was 0.869.
FPLC of RpFabG (9-6-2013)
In order to reduce chances of precipitation, the protein was purified and as quickly as possible was purified through FPLC. Unfortunately, when the samples were looked at, elution #1 had already partially precipitated. The elution #2s were thus concentrated for FPLC, and elution #1s were spun down to eliminate the precipitated protein and then concentrated as well. A sample of half concentrated elution #1 and half concentrated elution #2 was taken to FPLC. FPLC was ran as protocol states, the results are shown bellow.
Figure 4. The FPLC graph shows a lot of fluctuation of the UV line and a big change in conductivity towards the end of the run. This suggest that the new buffer was not properly ran through the column the previous night, thus the run is useless since no peak is noted.
Figure 3. The nanodrop of the combined elution #1 and elution #2 after they were concentrated for FPLC. The concentration was determined to be 2.03 mg/mL and the absorbance was 2.032.
RpFabG Protein Expression and Purification (9-5-2013)
After coming back from break, the protein that was prepared previously was found precipitated, so yet another round of protein expression had to be performed. Just like the previous times, everything was done the same, and the product from expression was sonicated followed by spinning down and purifying. The nanodrop results from elution #1 and elution #2 are shown bellow.
Figure 2. Elution #1 was nanodroped to determine the concentration and absorbance of the protein. It was found that elution 1 had a concentration of 0.29 mg/mL and an absorbance of 0.287 at 280nm.
Figure 1. Elution #2 was nanodropped to determine the concentration and absorbance of the sample of protein, it was determined that this sample had a concentration of 0.16 mg/mL and had an absorbance of 0.159 at 280nm.
Week 9:
Protein Characterization of RpFabG (7/30/2013)
A page gel was made and the samples that were collected throughout protein expression and purification were used to run the gel. The gel was then stained and destained, and finally was dried. The gel shows good carry over through out purification, and a thick band in elution #1. There was come contamination so FPLC was probably necessary to further purify the protein. When elution 1 and 2 were taken out of the refrigerator, it was found that the protein had precipitated and thus was useless for further use. So, protein expression would have to be started again to obtain more protein. Expression will be done on 7-31-2013 and sonication, the pellets will then be stored and used in the fall semester for the rest of the experiments.
Figure 1. Lane 1 has a protein ladder, lane 2 has sample 0 from expression, lane 3 has sample 1 from expression, lane 4 has sample 2 which is the soluble fractions, lane 5 has the flow through from purification, lane 6 has the wash from purification, lane 7 has sample 5 from elution #1, and lane 8 has sample 6 from elution #2.
Protein Purification of RpFabG (7/29/2013)
Once protein expression was done, the pellets were obtained, resuspended and then sonicated. The product was then spun down again and a pellet was obtained, of which the liquid was kept. Then the product was purified through protein expression. The resulting elution #1 and elution #2 were nanodropped to find their absorbance.
Figure 1. This is one of two measurements that were taken of elution #2. The average Abs. was 0.009.
Figure 2. This is one of two measurements that were taken of elution #1. In this one the Abs. is 1.349. The average Abs. was determined to be 1.1305.
Week 8:
Protein Expression/Characterization/Purification of RpFabG (7/26/2013)
Protein expression was started using an overnight culture of the transformed BL21 cells with the wanted plasmid. The cells were used to produce the RpFabG protein, which was then obtained by sonication. Next the protein was purified and was prepared to be characterized with a SDS-page gel.
(Results will be shown soon in week 9.)
Transformation: pNIC with RpFabG gene into BL21 cells (7/23/2013)
In order to begin protein expression, the current DH5 alpha cells with the pNIC plasmid had to be transformed by placing the wanted plasmid into BL21 competent cells. An overnight culture was made of the sample 3 colony, spun down and then used for midi-prep to extract and purify the plasmid. A transformation was then performed and let to incubate overnight. The next day the plates were checked for growth, and it was found that there were several colonies growing. These can now be used for protein expression.
Figure 1. This is one of two measurements of the concentration and purity of the pNIC-Bsa4 plasmid with the RpFabG gene after it was midi-preped. The average concentration was found to be 53.05 ng/uL, the average 260/280 value was 1.975 and the average 260/230 value was 3.515. The plasmid was then used for transformation.
Figure 2. The left plate shows the plate with 50 uL of the prepared mixture of plasmid, competent cells and SOC; the right plate shows the one that only had 10 uL added. There are several colonies growing on both plates which shows that the transformation was successful.
DNA Results for Cloning (7/22/2013)
Once the Core had the DNA sequence results, the result was compared to the known sequence of the target gene using BLAST. Each sample was compared and the coverage percent and the identity percent were looked at to determine if the cloning was a negative clone or a positive clone. It resulted that there were three positive clones in this master plate, samples 3, 4 and 8. Protein expression can now be started using these positive clones.
Table 1. The above table shows the sample/tube number, followed by the coverage percentage, the identity percent and last stating wether or not it was a positive clone. Positive clones are highlighted in green, and negative clones are shown in red. It is shown that samples 3, 4 and 8 are positive clones.
Figure 1. This is the BLAST comparison of the known sequence for RpFabG (Query) with the obtained sequence from sample 3. It is seen in the top of the figure that the alignment is a 100% match. This confirms that the sample is a positive clone and can be used for protein expression.
Week 7:
Restriction Enzyme Digest of Transformed pNIC-Bsa4 (7/20/2013)
In order to determine if the transformation of pNIC with the RpFabG gene worked correctly, a restriction enzyme digest was used to see if the gene was inserted correctly into the vector. NEB cutter was used to determine what enzymes should be used in order to successfully perform the digest. It was found that PvuII and SacII would be the best for the digest. If the cloning was successful then the enzymes would produce three bands, if it was unsuccessful then four bands would be produced.
Figure 1. On the right is the virtual gel of the unsuccessful transformation and on the left is the virtual gel of the successful transformation. If the transformation worked correctly, then there should be three bands and if it did not work correctly then there should be four bands.
Figure 2. Lane 1 - 1 kb DNA laddar, lane 2 - uncut pNIC plasmid, lane 3 - pNIC with enzymes, lane 4 - tube 1 content with PvuII and SacII, lane 5-12 - tube 2-9 content.
Figure 3. Lane 1 - 1 kb DNA Laddar, lane 2 - PvuII enzyme, lane 3 - SacII enzyme, lanes 4-12 - tubes 1-9.
The restriction enzyme digest was performed and a gel was ran to see the results. In the gel (Fig. 1) it is clear that there is a lot of contamination and it is not clear if the three bands are present or four. In order to see if there was contamination came from the original samples or the enzymes, another gel was ran with just the samples and no enzyme in them. From the gel it is visible that the enzymes nor the samples did not contain contamination. Hence it is not clear from the restriction enzyme digest if the cloning worked or not. To determine if the cloning worked, the DNA sequences will have to be analyzed.
Master Plate and Mini-prep of pNIC with RpFabG (7/19/2013)
Since the first transformation was successful at producing colonies, they were used to make a master plate and start overnight cultures. The master plate, once it was made, was incubates overnight in the incubator and the overnight cultures were placed in the shaker overnight. The next day the master plate was checked for growth and it was found that there were colonies growing as they should be. The cultures were then spun down and the pellets were used for mini-prep. After mini-prep was done, the samples were nanodropped and then sent off to sequencing. All of the tubes (1-9) were sequenced with pLIC-For and then the tubes with the top three concentrations were sequenced with pLIC-Rev.
Figure 1. This table shows the first and second sample concentrations of each tube, the average concentration of the sample, the average 260/280 values, and the average 260/230 values.
Fifth Round of Cloning of RpFabG in pNIC-Bsa4 (7/17/2013)
Due to the previous four failed rounds of cloning, yet another round of cloning was performed. This time after further discussion with mentors and Dr. Beckham, it was decided that a 1:8 ratio of vector to insert would be used and that the times of the procedure for annealing and transforming would be doubled. The PCR insert and cut pNIC that were prepared previously were used again for this round too. Tube A was prepared like always but this time, like mentioned previously, tube B was made with 1 uL of vector and 8 uL of insert. The room temperature incubation step time was doubled to 20 minutes, after the DH5 alpha cells were added, the mixture was iced for 1 hour, followed by a heat shock for 1.5 minutes. The remaining of the steps was done as stated in the protocol. The plates were incubated overnight and the next day were checked for growth. Finally, it was found that the plates had colonies and hence cloning was successful.
Figure 1. On the left is the plate with the content from tube A and on the right is the plate with the content from plate B. It is visible that there are few colonies growing on the plate, so they were used for the remaining of the cloning procedure.
Fourth Round of Cloning of RpFabG in pNIC-Bsa4 (7/16/2013)
Again since the first three rounds of cloning were unsuccessful at producing colonies another attempt of cloning was done. This time the higher concentration pNIC-Bsa4 was used and the higher concentration PCR squared product. Both were prepared with cohesive ends and then annealing and transformation was started. On this round, tube A remained the same as in all previous rounds, but again tube B was changed to 9 uL of vector and 12 uL of insert. The procedure was performed exactly as before, and the plates were incubated overnight. On the next day, the plates were checked for colony growth and none was found again.
Figure 1. The plate on the left is plate A which contains the content from tube A (2uL of vector and 4uL of insert). On the right is plate B which contains the content from tube B (9 uL of vector and 12 uL of insert). It is clear that there are no colonies growing on the plates, hence the cloning was again unsuccessful.
Week 6:
Oscar - show your PCR results (overlap, PCRsquared) - Dr. B 071713
Restriction Enzyme Digest of pNIC-Bsa4 Round 3 (7/12/2013)
After the third failed round of cloning, the concentration of pNIC was again tried to be increased in hopes that it would lead to a successful cloning. Again, after consulting with Dr. Beckham, it was determined that it would be best to prepare four tubes of pNIC in the R.E. digest and then PCR clean them together to achieve a higher concentration. The 50 uL final volume for the digest was still used and the four tubes were made after which they were cleaned into one sample. The sample was then nanodropped to determine the concentration. The higher pNIC concentration was finally achieved.
Figure 1. This is the first of two reading to determine the average concentration of the sample. It was found that the average concentration was 198.9 ng/uL, the average 260/280 value was 1.865 and the average 260/230 value was 2.345.
Third Round of Cloning of RpFabG in pNIC-Bsa4 (7/12/2013)
Since the second round of cloning failed to produce any colonies, a third round of cloning was performed. In this round the PCR insert came from the second round preparation and the pNIC from the second round were used. The only other thing that changed is that tube B contained 9 uL of vector and 16 uL of insert. All other steps were followed exactly as before. The plates were eventually incubated overnight and checked the next day. On the 13th the plates were checked and there were no colonies again on the plates.
Figure 1. The plate on the left shows the plate with the content from tube B (9 uL of pNIC and 16 uL of PCR insert) and on the right is the plate with the content from tube A (2 uL of pNIC and 4 uL of insert). Again there are no colonies visible.
Second Round of PCR squared Preparation (7/12/2013)
Since two round of cloning were performed, all of the PCR insert that was prepared was used up and so more had to be made. Using the remaining secondary PCR product, another round of PCR squared was performed and then cleaned with a PCR clean up kit. The sample was then nanodropped to determine the concentration of this sample.
Figure 1. This is the first sample of two to determine the average concentration of the sample. The average concentration was found to be 251.1 ng/uL, the average 260/280 value was 1.865 and the average 260/230 value was 2.34.
Second Round of RpFabG in pNIC-Bsa4 Cloning (7/12/2013)
Since the first round of cloning failed to produce any colonies, a second round was performed. Since there was still accepting vector and PCR insert from the previous round, they were used for this round. Tube A contained the same rations as last time, but tube B had 3 uL of accepting vector and 4 uL of insert, everything else was kept the same. The plates were checked the next day (7/13/2013) and it was found that there were no colonies either. Figure 1. In the figure plate A (on left) contains the content from tube A, 2 uL of accepting vector and 4 uL of PCR insert. The plate on the right is plate with the content of tube B, 3 uL of vector and 4 uL of PCR insert. It is clear that there are no colonies growing on the plates.
Rerun of pNIC-Bsa4 DNA Sequence Results (7/11/2013)
The Core reran the sample of pNIC-Bsa4 that was submitted the second time, and the resulting sequence is shown below.
Using this new sequence, a BLAST was performed against the known databank to see what would result. It turned out that the sequence was not an 83% match to pNIC28-Bsa4 but a 99% match. To further test the match, a BLAST alignment was also done on the obtained sequence and the known sequence of pNIC-Bsa4. It resulted the same as the first BLAST, indicating that it was also a 99% match to pNIC-Bsa4.
Figure 1. A BLAST was conducted with the resulting DNA sequence against all of the NCBI database to see what it was the most similar to. It showed that the sequence was an almost perfect match to expression vector pNIC28-Bsa4.
Figure 2. Furthermore, a BLAST alignment was also conducted using the sequence from the core and the known sequence of pNIC-Bsa4. It also resulted in a 99% match.
These results indicate that the first read was just a bad read, and that the pNIC-Bsa4 that was obtained from the Midi-prep is more than suitable for cloning of RpFabG.
Second Round of R.E. Digest of pNIC-Bsa4 (7/10/2013)
Due to the failure of the cloning, it was suspected that the low concentration of pNIC was the issue. In hopes to change this, the pNIC concentration was attempted to be increased. After speaking to Dr. Beckham, it was determined that the final volume of the RE Digest of pNIC should be increased to 50 uL thus allowing for a full 2.25 ng of plasmid to be added. This was done and the pNIC was then PCR cleaned up and then nanodroped to find the concentration.
Figure 1. This is the first of two reads of the concentration of the pNIC, the concentration was 49.2 ng/uL, it is clear that the concentration has increased from the first round, though it is still not in the desired range. The average concentration of the sample was 48.85 ng/uL, the 260/280 value was 1.795 and the average 260/230 value was 2.015 ng/uL.
First Cloning of RpFabG in pNIC-Bsa4 Results (7/10/2013)
Cloning was finally started, which involves the cohesive end generation of the cut pNIC-Bsa4 and the PCR squared cleaned product, annealing and then transformation. The protocol was followed in order to produce the cohesive ends on the insert and the vector which prepares them to be joined together. After they were ready two separate tubes were made, tube A with 2 uL of vector and 4 uL of insert, and tube B with 3 uL of both insert and vector. The mixture was then iced and heat shocked followed by adding SOC for the bacteria to grown. The mixture was then plated on kanamycin and sucrose plates and incubated overnight. The next day the plates were checked for any colony growth but it was found that there were no colonies growing.
Figure 1. On the left is plate A which has the content from tube A (2 uL of vector and 4 uL of insert) and on the right is the plate with the content of tube B (3 uL of insert and 3 uL of vector).
RE Digest of pNIC-Bsa4 with BsaI (7/10/2013)
In order to determine if the pNIC-Bsa4 that was used for the cloning was cut correctly by the BsaI, a virtual digest was done in order to see what the results should look like. A virtual gel was obtained with a 1 kb DNA ladder in order to compare actual gel results.
Figure 1. NEB cutter was used to perform a custom digest with the restriction enzyme BsaI. A virtual gel was also obtained of this digest in order to compare results of actual gel. Two bands should be visible, one between 6 and 5 kbps and one at 2 kbps.
Figure 2. A 1.3% agarose gel was made with lane 3 containing the 1 kb DNA Ladder and lane 4 containing the cut pNIC-Bsa4 sample. It is clear that there is one band between the 5 and 6 kbp band and anther band at the 2000 bps band. This indicates that the pNIC-Bsa4 was cut correctly at the appropriate places and was ready for cloning.
Using the DNA sequence, a BLAST was conducted against all the known database and it resulted with a 83% match to pNIC28-Bsa4. Additionally, a BLAST was conducted with the known sequence of pNIC-Bsa4 and again an 83% match resulted.
Figure 1. A BLAST was ran with the resulting DNA sequence from the core, against all of the known database. It showed that the sample DNA was an 83% match to pNIC28-Bsa4.
Figure 2. Additionally, a BLAST sequence alignment was performed against the known sequence of pNIC-Bsa4. Again, it resulted in an 83% match to the known sequence of pNIC-Bsa4.
After some analysis, it was determined that the DNA sequence was a bad read and that it would be best to resubmit to DNA sequencing. Interestingly, the CORE emailed saying that they have had some bad DNA sequencing results lately and that they will be re-running my sample and results will be available on the 11th.
Preparation of pNIC-Bsa4 for Cloning (7/8/2013)
The pNIC-Bsa4 that was purified from the overnight culture with midi-prep was digested with the restriction enzyme BsaI in order to prepare it for cloning.
Figure 1. The first measurement of the cut pNIC-Bsa1 showed that the concentration was 28 ng/uL, the 260/280 value was 2.03 and the 260/230 value was 2.29. This indicates that the sample is relatively pure relative to proteins and other contaminants, and has a good yield.
Figure 2.The second measurement of the cut pNIC-Bsa1 showed that the concentration was 25 ng/uL, the 260/280 value was 2.23 and the 260/230 value was 2.24. This indicates that the sample is relatively pure relative to proteins and other contaminants, and has a good yield.
The average concentration of the sample was 26.5 ng/uL, the average 260/280 value was 2.13, and the average 260/230 value was 2.265. The sample is now ready for cloning of RpFabG into the pNIC-Bsa4 plasmid.
Week 5:
Midi-Prep of pNIC-Bsa4 Round 2 (7/6/2013)
From the second round of Midi-Prep of pNIC-Bsa4, it was determined that the average concentration of the sample was about 61.95 ng/uL, the average 260/280 value was 1.955 and the average 260/280 value was 25.36. This shows a better yield then the first round of Midi-Prep, but a worse purity then before.
Figure 1. This first measurement of the pNIC-Bsa4 sample shows that the concentration is 61.3 ng/uL, the 260/280 value was 1.94 and the 260/230 value was 28.04.
Figure 2. This is the second measurement of the pNIC-Bsa4 sample that shows that the concentration was 62.6 ng/uL, the 260/280 value was 1.97, and the 260/280 value was 22.68.
Nanodrop of RpFabG PCR After Clean Up (7/6/2013)
From the successful secondary PCR, a PCR squared was conducted and the resulting PCR sample was purified using a Sigma PCR clean up kit. The resulting sample was Nanodroped to determine the concentration and purity. The average concentration was determined to be 176.1 ng/uL, the average 260/280 value was 1.815 and the average 260/230 value was 2.23. This indicates that the sample was pure relative to protein and other contaminates and had a good yield.
Figure 1. The first sample measurement of the RpFabG from the PCR clean up kit showed that the concentration was 177.4 ng/uL, the 260/280 value was 1.79 and the 260/230 value was 2.16.
Figure 2. The second sample measurement from the RpFabG sample after the PCR clean up kit was used to purify the PCR squared results. This shows that the concentration was 174.8 ng/uL, the 280/260 value was 1.84, and the 260/230 value was 2.30.
RpFabG PCR Primer Overlap [Secondary PCR Option B] (7/5/2013)
Figure 1. Lane 4 contains a 1 kb DNA Ladder and lane 5 has the sample from the secondary PCR done with option B (using the tail primers). It should be noted that when the agarose gel was made a mistake was made and the gel wells did not form correctly, most wells had bubbles and were collapsed. The two best lanes were used to run the sample. It is evident that the ladder did not run properly, but it can still be seen where each band is on the ladder. The sample of the PCR though ran perfectly, and is located in the right size (between the 1 kbp band and the 0.5 kbp band). Hence, the secondary PCR was successful.
pNIC-Bsa4 DNA Sequencing Results (7/5/2013)
DNA sequence result were obtained from the Core and analyzed to determine if the sample contains the correct plasmid.
A BLAST was then conducted to see if the sequence was similar to any other known sequences. From the results (shown below) it can be seen that there is an 98% match to expression vector pNIC28-Bsa4, complete sequence. Just to further conclude that the sequence was a match for pNIC-Bsa4, an alignment BLAST was done.
Figure 1. The BLAST of the obtained sequence against all known sequences. It shows that there is a 98% match to the expression vector pNIC28-Bsa4, complete sequence.
The alignment BLAST (shown below) also resulted in a 98% match to the known sequence of pNIC-Bsa4. Hence, the sample that was obtained from the Midi-Prep did result in pNIC-Bsa4 plasmid, but from the Nanodrop it was evident that the sample was not pure, so a second Midi-prep was done in hopes to better the yield and purity.
Midi-Prep of pNIC-Bsa4 (7/3/2013)
An overnight culture was started of pNIC-Bsa4 in 160 mL of LB media, the culture was then centrifuged and the pellet that was obtained was used for the Midi-prep. Once the Midi-Prep was complete, Nanodrop was used to determine the concentration of the resulting plasmid. A sample was also submitted to DNA sequencing to ensure that the correct plasmid was extracted into the sample.
Figure 1. The first sample of the pNIC-Bsa4 shows that the concentration is 40.4 ng/uL, the 260/280 value is 2.01, and the 260/230 value is 14.09. The 260/280 value, which indicated the contamination relative to other protein, was at an acceptable range and indicates a pure sample. On the other hand, the 260/230 value which indicates the contamination relative to other contaminates, is 14.09 which is extremely high. To make sure that the sample is good, it was submitted to DNA sequencing.
Figure 2. The second sample of the pNIC-Bsa4 shows a concentration of 39.6 ng/uL, a 260/280 value of 1.99, and a 260/230 value of 12.54. The 260/280 value is again in a good range and indicates that the sample doesn't have much protein contamination. But yet again, the 260/230 value is 12.54 and is very high and is indicative of a lot of contamination.
RpFabG Overlap PCR (7/3/2013)
Targets were assigned on monday and it was determined that I will be working on FabG 3-ketoacyl-(acyl-carrier-protein) reductase (RpFabG). It should be noted that the RpFabG gene contains 726 bp's and will be placed into a pNIC-Bsa4 accepting vector, of about 5358 bp's. To start on the target work, an overlapping PCR was started, consisting of a primary and secondary PCR, eventually followed by a PCR squared. Below are the results from the first two PCRs.
Figure 1. Lane 1 through lane 4 belong to Melissa H. lanes 5 through 7 belong to Oscar V.. Lane 5 contains a 1 kb DNA Ladder, lane 6 has the sample from the primary PCR, and lane 7 had the secondary PCR. Lane 6 shows the smear that indicates that the first PCR worked and lane 7 shows a band somewhere between the 1000 bp and 500 bp bands on the ladder, which is ideal since the gene is about 700 bp long. Thus the PCR worked well and PCR squared can be started.
Restriction Enzyme Digest (7/2/2013)
Due to the fact that the first restriction enzyme digest did not work properly, which was though to have been cause by contaminated pGBR22, a second restriction enzyme digest was ran. To ensure that the results from the first RE digest were due to the contaminated pGBR22, an uncut plasmid sample from the first trail was ran along with the new samples. The results are good and show proper plasmid sizes, which are similar to the virtual gel that was previously completed.
Figure 1. Lane 1 contains the 1 kb DNA Ladder, lane 2 contains the sample from the uncut plasmid that was used for the digest, lane 3 has the plasmid with the EcoRI enzyme, lane 4 has the plasmid along with the PvuII enzyme, lane 5 contains the plasmid and both EcoRI and PvuII enzymes, and lastly lane 6 has the uncut plasmid sample from the past RE digest. It is interesting that the shape of the resulting bands is not the typical rectangle but a U-shape. Lane 2 shows the uncut pGBR22 plasmid but has some contamination. Lanes 3 and 4 have good signal and are the appropriate sizes, which is determined from the virtual gel that was previously ran. Lane 5 has two very clear bands, but the third band is not very visible since its signal is weak, but it can be seen. And finally, it was determined that the plasmid that was used for the first RE Digest was not contaminated and that the three bands that are visible are normal.
Protein Characterization (7/2/2013)
Figure 1. The completed protein gel of the FtHap in pNic-Bsa4 is shown above with lane 0 being the protein ladder, lane 1 being the sample from the cell lysate before induction, lane 2 is the sample from the cell lysate after induction, lane 3 is the sample from soluble fraction, lane 4 being the sample from the flow through, lane 5 is the wash sample, lane 6 is the sample from elution 1 and lane 7 is the sample from elution 2. Unfortunately, while running the gel we had substantial "smiling" of the gel thus creating the normal curve at the bottom of the gel. Nevertheless, the results are pretty good since there isn't much contamination in lane 6 (there is a clear band as there should be) and the other lanes look as they should also.
Primer Design (7/1/2013)
Tail primers, forward and reverse, for Dihydrofolate reductase - thymidylate synthase were made and ordered for individual project
0 mM Mg2+ Tm 66.5_ oC 1.5 mM Mg2+ Tm _73.6_ oC 2 mM Mg2+ Tm _74.0 oC 4 mM Mg2+ Tm _74.7 oC 6 mM Mg2+ Tm _75.1__ oC
Reverse Primer:
5’-CTCTATGGAAATGGCGGTGTAACAGTAAAGGTGGATA-3’
Reverse complement it:
5’-TATCCACCTTTACTGTTACACCGCCATTTCCATAGAG-3’ 37 bp
GC Content _43.2%
0 mM Mg2+ Tm _62.8 oC 1.5 mM Mg2+ Tm _70.5 oC 2 mM Mg2+ Tm _71.6_ oC 4 mM Mg2+ Tm _72.4 oC 6 mM Mg2+ Tm _72.8__ oC
Figure 1. A custom digest of pNIC-Bsa4 was conducted using the restriction enzyme BsaI. The sites where the enzyme would cut the pNIC plasmid are depicted above.
Week 4:
Restriction Enzyme Digest (6/28/2013)
Figure 1. The above shows the gel obtained from running the restriction enzyme digest on an agarose gel. In lane one a 1 kb DNA ladder was placed, in lane 2 there is a sample of pure pGBR22 plasmid, lane 3 has the EcoRI enzyme, lane 4 has PvuII enzyme, and lane 5 has EcoRI and PvuII enzymes. It is apparent that none of the samples worked correctly. Lane 2 should only show one band in the 400 bp range and instead shows three bands that are too big to be pGBR22. This is likely due to contamination. In order to better understand this, further test will be conducted and the restriction enzyme digest will be done again with a different sample of pGBR22 plasmid.
Protein Characterization (6/28/2013)
Results will be posted in week 5 since the gel is destaining over the weekend.
Protein Purification (6/26/2013)
Using the pellet that was obtained from protein expression, sonication, and the spin-down, the protein was purified and several samples were collected. From the first and second elution that were collected from the purification, nanodrop was used to determine their absorbance at 280 nm. The results are shown bellow. Figure 1. This is the result from elution 1. It shows that the average absorbance is 0.0835 and the 260/280 value was 1.105.
Figure 2. This is the results from the nanodrop of elution 2. The average absorbance was 0.022 and the average 260/280 value was 0.1.
The E value of the protein was determined to be 53290, the concentration of elution 1 was 1.57 uM, the concentration of the second elution was 0.41 uM, the yield of the first elution was found to be 7.85 mg, and the yield of elution 2 was 2.05 mg.
Figure 1. This shows the BLAST results when the obtained pGBR22 sequence was ran against the human genome. It is evident that there was not a match.
Figure 2. Next a BLAST was ran against all other genomes to see any posible matches. The results show that there is a 99.9% match to monopora efforescens GFP-like chromoprotein mRNA complete cds.
A comparison was conducted between the known DNA sequence of pGBR22 and the obtained sequence from the Core. The results show that the sequences were a 99.9% match. The sequence only had 1 mismatch where a G was replaced with an A. (BLAST pictured below)
The sequence was then translated into its protein sequence, and then ORF Finder was used to find the correct reading frame. It was determined that the third reading option, the second frame in the forward direction, was the correct reading frame for the sequence.
An enzyme digest was conducted virtually using the completed pGBR22 plasmid, for the first trail EcoRI was used, for the second PuvII was used, and the third used both EcoRI and PuvII. The virtual gel that was obtained is depicted below.
Week 3:
Protein Expression (6/19/2013)
Protein expression was conducted using FtHap in pNIC-Bsa4. The OD600 value of the culture was monitored using a spectrophotometer until it had reached 0.1. The following is the log of the results.
Time
OD600 value
Notes
10:48 am
0.017
After added 10 mL of sample to flask
10:57 am
0.045
After a total of 15 mL had been added
11:01 am
0.069
After a total of 20 mL had been added
11:05 am
0.09
After a total of 25 mL had been added
The culture was then incubated and the OD600 value was monitored every 30 minutes. The following is the log of that process.
Time
OD600 Value
Notes
11:42 am
0.105
n/a
12:12 am
0.136
n/a
12:42 pm
0.137
n/a
1:04 pm
0.175
n/a
Then 250 uL of IPTG was added to culture. The culture was transfered into a bottle and then centrifuged at 6000 g at 4 degree C for 20 minutes. Pellet was then obtained and weighed. The pellet weighed 0.69 grams. 10 mL of buffer were then added to pellet and dissolved. The solution was then split into two 15 mL tubes and placed into the -80 degree C freezer.
Verification of pGBR22 Plasmid (6/18/2013)
Figure 1. After the BLAST was conducted, it was determined that the plasmid that was submitted was 100% match to pGBR22. Hence, the sample was moved to verified plasmid box.
Agarose Gel of pNIC with pLIC Primers (6/17/2013)
Figure 1. This agarose gel shows the result of the first trial of the PCR of pNIC plasmid using pLIC forward and reverse primers. In lane 1 there is a 1 kb DNA ladder, in lane 2 the low concentration sample was ran, the medium concentration sample is in lane 3, the high concentration sample is in lane 4, and the control with no DNA template is in the 5th lane. It is evident that the gel did not run very well since the ladder didn't even show up correctly. But there is a band in lane 2 and 4 that show successful amplification of the plasmid. Since the 4th lane has a higher concentration, it is expected that it has more amplification and a stronger signal, and this is seen in the gel.
Week 2:
Agarose Gel of pmCHERRY (6/14/2013)
Figure 1. This is the agarose gel for the second trial of the pmCHERRY plasmid. Lane 1 has the 100kb DNA ladder, lane 2 has sample 1, lane 3 has sample 2, lane 4 contains the sample from 3, lane 5 the 4th sample, lane 6 has the 5th sample, lane 7 has sample 6, lane 8 has sample 7, lane 9 has sample 8, and lane 10 has sample 1 from the previous PCR trail (which the gel failed for). It is evident that there is a signal from lanes 3 and 4, which contain the higher concentrations of the DNA template and has VDSR1 and VDSR2 primers. This probably indicates that the PCR for the VDSR primers was successful, but the PCR for the M13 primers was not, since there is no signal from any of its lanes. The anneal temperature for the PCR of the M13 primers was probably set at the wrong temperature and thus caused the PCR to be unsuccessful. Also, lane 10 has no signal, which could be due to the fact that only 5 uL of the sample were used or because the previous PCR failed the first time.
Figure 2. The gel of the pmCHERRY. Lane 1 is empty, Lane 2 contains sample 8, lane 3 contains sample 7, lane 4 has the sample from 6, lane 5 has the sample from 5, lane 6 has the sample from 4, lane 7 has the sample from 3, lane 8 has the sample from 2, lane 9 has the sample from 1, and lane 10 has the 1 kb DNA ladder. It is evident that there is no signal from the DNA in the gel. This is most likely due to the fact that the buffer was confused when the gel was ran and ended up being ran with 1xTBE instead 1xTAE. The plasmid PCR will be redone and another agarose gel will be done.
Midi-Prep (6/12/2013)
The sample of the DNA that was obtained from the midi prep kit had an average concentration of 180.7 ng/uL
and from the Nanodrop values it seems that the sample does not contain many contaminants. In order to ensure that the DNA that was obtained is the wanted DNA with the pGBR22 gene, the DNA sample was submitted to DNA sequencing. Below are the Nanodrop images that were obtained from the two measurements in order to determine the concentration of the sample.
Figure 1. This is the result after the midi prep kit was used on the overnight E.coli culture, that was transformed
with the pGBR22 gene, to extract the transformed DNA plasmid from the E.coli bacterial cells. The resulting DNA concentration was then measured using Nanodrop. From the first measurement, the resulting concentration was found to be 171.5 ng/uL, the 260/280 value was 1.93 and the 260/230 value was 2.4. The 260/280 value (ideally 1.8) indicates that the sample had a good purity relative to protein, and the 260/230 value (ideally 2.1) indicates that the sample was relatively pure relative to contaminates. Thus, the sample had a good yield.
Figure 2.This is the result after the midi prep kit was used on the overnight E.coli culture, that was transformed
with the pGBR22 gene, to extract the transformed DNA plasmid from the E.coli bacterial cells. The resulting
DNA concentration was then measured using Nanodrop. From the second measurement, the resulting concentration
was found to be 189.9 ng/uL, the 260/280 value was 1.90 and the 260/230 value was 2.63. The 260/280 value (ideally 1.8)
indicates that the sample had a good purity relative to protein, and the 260/230 value (ideally 2.1) indicates that
the sample was relatively pure relative to contaminates. Thus, the sample had a very good yield.
Agarose Gel of PCR Plasmid (6/11/2013)
Figure 1. The agarose gel contains a 1kb DNA Ladder (the left well), lane 2 has the content from tube A from the PCR, lane 3 has the content of tube B, the 4th lane has the content from tube C, and the 5th lane has the content of tube D. It is evident that there is no signal from lane 2 which must be due to an error in the PCR, and there is also no signal from the 5th lane, but thats due to the fact that tube D had no plasmid so it's not suppose to have a signal. Lane 3 and 4 have a weak signal but do show up a little in the UV light.
Transformation Efficiency (6/10/2013)
Figure 1. This plate shows the content from tube C, which contained the LB, ampacilin, and pGBR22. Tube C only contained
25 ng of the plasmid. After incubation, the plate resulted to have about 4188 colonies, indicating that the efficiency was 167.52
colonies per ng of plasmid. Figure 2. This plate shows the content from tube B, which contained the LB, ampacilin, and pGBR22. Tube B only contained
5 ng of the plasmid. After incubation, the plate resulted to have about 676 colonies, indicating that the efficiency was about
135.2 colonies per ng of plasmid. Figure 3. This plate shows the content from tube A, which contained the LB, ampacilin, and pGBR22. Tube A contained
1 ng of the plasmid. After incubation, the plate showed no colonies, which could mean that there was either an efficiency
of 0 colonies per ng of plasmid or that something went wrong which lead to the lack of colony growth.
Week 1:
Nanodrop Spectrophotometer (6/4/2013)
Figure 1. The above figure is a screenshot of the result of the first round of measurements of the pGBR22. It showed that the concentration was 191.5 ng/uL, furthermore indicating that the concentration is approximately 0.1915 ug/ul. The 260/280 value, which is the purity of the DNA in relation to protein, was 1.93 which ideally would be around 1.8, indicating that the DNA was relatively pure in the sample. The 260/230 value, which indicated the purity of the DNA relative to other contaminants, was 2.73. The 260/230 value should ideally be around 2.1, showing that the sample was not very pure and had several contaminants.
Figure 2. The above figure is a screenshot of the result of the second round of measurements of pGBR22. It showed that the concentration was 189.9 ng/uL, furthermore indicating that the concentration is approximately 0.1899 ug/ul. The 260/280 value was 1.90 indicating that the DNA was relatively pure even a little more than sample one. The 260/230 value was 2.63, showing that the sample was not very pure and had several contaminants but was a little more pure than the first sample.
Fall 2013
Weeks 7 and 8
RpFabG Enzyme Assays (10-15-13)
Enzyme assays were again performed using the newly made protein. The first assay was done and enzyme was continuously added until a significant decrease in absorbance was seen. This happened at about 400uL of enzyme, so this was done multiple times to ensure the reproducibility of the results. Each time, a relatively constant decrease was seen in the absorbance after the enzyme was added. This interval was then used to determine the slopes of each of these reactions. These slopes further proved that the results were reproducible. Next the Km values for both the NADPH and AAC will be obtained for inhibition assay purposes.RpFabG Enzyme Assays (10-11-13)
In this round of assays, the concentration of all the components were changed to see if any combination gave a good read. The fifth assay shows that there is a small decrease in the absorbance so for the sixth assay an extreme amount of enzyme was added, and it showed to have worked as it showed a decrease in the absorbance. However, in the process all of the RpFabG protein that was stored in glycerol was used up leaving only -80 degree frozen protein. The seventh assay shows that the frozen protein was not functional hinting that that is not a proper storage condition for this protein. Furthermore, more RpFabG was made through expression and was purified and all of the sample was stored in glycerol.Weeks 5 and 6
RpFabG Enzyme Assays (10-5-13)
Since a relatively pure sample of protein was obtained from the previous expression and purification round, enzyme assays were conducted using the RpFabG protein. Two substrates were used, NADPH and ethylacetoacetate sodium salt (EAA). A 2xbuffer was also made for the assays in order to maintain the enzyme at proper functional conditions, the same buffer that was used for FPLC was made except that all the concentrations were doubled. Five assays were ran, each one was basically done the same way, first water and buffer was added, then NADPH, then RpFabG enzyme and then EAA. When the NADPH was added the absorbance was measured at 340 nm and more NADPH was added until the absorbance was between 1.0 and 1.5. Once the NADPH was added, the enzyme was added and the abs. monitored. When it stopped fluctuating, the EAA was added. The whole reaction was typically monitored every 10 seconds for about 20 minutes. In the assays where the absorbance did not change after the enzyme was added, more enzyme was added. Each assay had different results. The analyzes is still pending as to determine if the enzyme is functional or not.Purification Using an Imidazole Concentration Gradient (10-3-13)
Since FPLC was not working effectively to purify the RpFabG protein, a different method was again attempted to purify the protein. This time a gradient of increasing imidazole concentration was used to slowly collect the protein and reduce the contamination of other proteins. Nine elutions were collected and nanodropped to determine the concentration of protein in each. The chart bellow shows the concentration of the nine samples. After this the samples were ran on a page gel that showed that the samples were pure enough to attempt enzyme assays using the protein. Hence the samples were pooled together and concentrated to about 2 mL of volume, the sample was then nanodropped to determine the collective concentration of the sample. The protein was then stored in the -80 and -20 freezers.FPLC of RpFabG Round (9-28-13)
After the two samples of RpFabG were combined and purified, they were reconcentrated in order to FPLC. The sample was then taken to the FPLC and ran. The graph showed no significant peaks indicating that there wasn't protein in the sample. The small peak around 125 minutes is not significant enough to use. Alternate methods will again be attempted.RpFabG Expression and Purification (9-28-13)
More RpFabG was expressed so that more trials of purification could be attempted. This time a new protocol was followed, growing the culture for 24 hours instead of 4 hours. Two liters were also made on this round, all samples were sonicated and stored in the -20 freezer. Two of the samples were combined and purified. The elutions were then nanodropped and reconcentrated for FPLC purposes.Weeks 3 and 4
Oscar - include your week 4 FPLC images. Its important to document failure! Dr. B 100113
Purification of RpFabG with TEV
After the TEV had been purified, it was placed with the previously purified RpFabG protein and buffer exchange through dialysis was performed. After this, the sample was purified yet again using a Ni column and then the samples were nanodropped.Figure 4. Once the TEV was ready for usage, it was placed in the dialysis cassette overnight with the RpFabG protein, from the previous purification round, for the buffer exchange. The next day, the cleaved protein was purified for a third time using a Ni column and the samples were nanodropped to determine the concentration and purity of each. Since TEV cleaves off the His-tag on proteins, it would hinder the Ni to attach to RpFabG hence causing it to flow through into the waste container in purification. The wash from the second purification is shown above. The concentration was 0.16 mg/mL and the 260/280 value was 2.02.
TEV Expression, Purification and Characterization
Since purification through FPLC did not function effectively, purification using TEV protease was used to cleave the His-tag off of the RpFabG protein, hence when the protein passes through the Ni column it will flow through and other contaminating protein will be retained. The results of the concentration after the purification of TEV is shown bellow.Figure 3. TEV was made for the use of purifying the RpFabG protein. TEV was expressed and purified and the nanodrop of the samples were collected. The nanodrop of the first elution is shown above. The concentration was 0.91 mg/mL and the 260/280 value was 1.86.
Purification of RpFabG
Since more rounds of purification will have to be performed, more RpFabG was expressed and purified. This time though, the sample was passed through the Ni-NTA column twice in order to increase the chances of eliminating contamination. The results were then nanodropped to determine the concentration of the samples.Figure 2. As previously stated, this sample of RpFabG was purified twice, this is the nanodrop of the first elution from the second round of purification. The concentration was 0.43 mg/mL and the 260/280 value was 2.16.
FPLC of RpFabG- Round 3
Anther round of FPLC was performed on the sample since a peak in UV has yet to appear. A sample of RpFabG protein was used and the results are shown below. Again, the FPLC failed to produce significant results. At this point, alternate methods of purification will be explored.
Figure 1. A third round of FPLC was performed on more RpFabG sample. The resulting graph is shown above. Yet again, the solid blue line depicting the UV reading, shows no significant peak indicating a lack of purified protein yet again.Week 1 & 2
Oscar - good work. Dr. B 090913
FPLC of RpFabG-Round 2 (9-7-2013)
Since the first FPLC failed to give good results, another FPLC was conducted on the sample from elution #1. Everything was done according to protocol. The results are shown bellow. The graph shows no significant peaks so no protein was collected. Another round of expression, purification, characterization and FPLC will have to be done in order to obtain the protein.
Figure 6. The graph shows no noticeable peak in the UV line, indicating that there was no protein. No samples were collected.
Figure 5. Elution #1 was nanodropped to determine the concentration of the protein. It was found that it was 0.87 mg/mL and the absorbance was 0.869.FPLC of RpFabG (9-6-2013)
In order to reduce chances of precipitation, the protein was purified and as quickly as possible was purified through FPLC. Unfortunately, when the samples were looked at, elution #1 had already partially precipitated. The elution #2s were thus concentrated for FPLC, and elution #1s were spun down to eliminate the precipitated protein and then concentrated as well. A sample of half concentrated elution #1 and half concentrated elution #2 was taken to FPLC. FPLC was ran as protocol states, the results are shown bellow.Figure 4. The FPLC graph shows a lot of fluctuation of the UV line and a big change in conductivity towards the end of the run. This suggest that the new buffer was not properly ran through the column the previous night, thus the run is useless since no peak is noted.
Figure 3. The nanodrop of the combined elution #1 and elution #2 after they were concentrated for FPLC. The concentration was determined to be 2.03 mg/mL and the absorbance was 2.032.
RpFabG Protein Expression and Purification (9-5-2013)
After coming back from break, the protein that was prepared previously was found precipitated, so yet another round of protein expression had to be performed. Just like the previous times, everything was done the same, and the product from expression was sonicated followed by spinning down and purifying. The nanodrop results from elution #1 and elution #2 are shown bellow.Figure 2. Elution #1 was nanodroped to determine the concentration and absorbance of the protein. It was found that elution 1 had a concentration of 0.29 mg/mL and an absorbance of 0.287 at 280nm.
Figure 1. Elution #2 was nanodropped to determine the concentration and absorbance of the sample of protein, it was determined that this sample had a concentration of 0.16 mg/mL and had an absorbance of 0.159 at 280nm.
Week 9:
Protein Characterization of RpFabG (7/30/2013)
A page gel was made and the samples that were collected throughout protein expression and purification were used to run the gel. The gel was then stained and destained, and finally was dried. The gel shows good carry over through out purification, and a thick band in elution #1. There was come contamination so FPLC was probably necessary to further purify the protein. When elution 1 and 2 were taken out of the refrigerator, it was found that the protein had precipitated and thus was useless for further use. So, protein expression would have to be started again to obtain more protein. Expression will be done on 7-31-2013 and sonication, the pellets will then be stored and used in the fall semester for the rest of the experiments.Figure 1. Lane 1 has a protein ladder, lane 2 has sample 0 from expression, lane 3 has sample 1 from expression, lane 4 has sample 2 which is the soluble fractions, lane 5 has the flow through from purification, lane 6 has the wash from purification, lane 7 has sample 5 from elution #1, and lane 8 has sample 6 from elution #2.
Protein Purification of RpFabG (7/29/2013)
Once protein expression was done, the pellets were obtained, resuspended and then sonicated. The product was then spun down again and a pellet was obtained, of which the liquid was kept. Then the product was purified through protein expression. The resulting elution #1 and elution #2 were nanodropped to find their absorbance.Figure 1. This is one of two measurements that were taken of elution #2. The average Abs. was 0.009.
Figure 2. This is one of two measurements that were taken of elution #1. In this one the Abs. is 1.349. The average Abs. was determined to be 1.1305.
Week 8:
Protein Expression/Characterization/Purification of RpFabG (7/26/2013)
Protein expression was started using an overnight culture of the transformed BL21 cells with the wanted plasmid. The cells were used to produce the RpFabG protein, which was then obtained by sonication. Next the protein was purified and was prepared to be characterized with a SDS-page gel.(Results will be shown soon in week 9.)
Transformation: pNIC with RpFabG gene into BL21 cells (7/23/2013)
In order to begin protein expression, the current DH5 alpha cells with the pNIC plasmid had to be transformed by placing the wanted plasmid into BL21 competent cells. An overnight culture was made of the sample 3 colony, spun down and then used for midi-prep to extract and purify the plasmid. A transformation was then performed and let to incubate overnight. The next day the plates were checked for growth, and it was found that there were several colonies growing. These can now be used for protein expression.Figure 1. This is one of two measurements of the concentration and purity of the pNIC-Bsa4 plasmid with the RpFabG gene after it was midi-preped. The average concentration was found to be 53.05 ng/uL, the average 260/280 value was 1.975 and the average 260/230 value was 3.515. The plasmid was then used for transformation.
Figure 2. The left plate shows the plate with 50 uL of the prepared mixture of plasmid, competent cells and SOC; the right plate shows the one that only had 10 uL added. There are several colonies growing on both plates which shows that the transformation was successful.
DNA Results for Cloning (7/22/2013)
Once the Core had the DNA sequence results, the result was compared to the known sequence of the target gene using BLAST. Each sample was compared and the coverage percent and the identity percent were looked at to determine if the cloning was a negative clone or a positive clone. It resulted that there were three positive clones in this master plate, samples 3, 4 and 8. Protein expression can now be started using these positive clones.Table 1. The above table shows the sample/tube number, followed by the coverage percentage, the identity percent and last stating wether or not it was a positive clone. Positive clones are highlighted in green, and negative clones are shown in red. It is shown that samples 3, 4 and 8 are positive clones.
Figure 1. This is the BLAST comparison of the known sequence for RpFabG (Query) with the obtained sequence from sample 3. It is seen in the top of the figure that the alignment is a 100% match. This confirms that the sample is a positive clone and can be used for protein expression.
Week 7:
Restriction Enzyme Digest of Transformed pNIC-Bsa4 (7/20/2013)
In order to determine if the transformation of pNIC with the RpFabG gene worked correctly, a restriction enzyme digest was used to see if the gene was inserted correctly into the vector. NEB cutter was used to determine what enzymes should be used in order to successfully perform the digest. It was found that PvuII and SacII would be the best for the digest. If the cloning was successful then the enzymes would produce three bands, if it was unsuccessful then four bands would be produced.Figure 1. On the right is the virtual gel of the unsuccessful transformation and on the left is the virtual gel of the successful transformation. If the transformation worked correctly, then there should be three bands and if it did not work correctly then there should be four bands.
Figure 2. Lane 1 - 1 kb DNA laddar, lane 2 - uncut pNIC plasmid, lane 3 - pNIC with enzymes, lane 4 - tube 1 content with PvuII and SacII, lane 5-12 - tube 2-9 content.
Figure 3. Lane 1 - 1 kb DNA Laddar, lane 2 - PvuII enzyme, lane 3 - SacII enzyme, lanes 4-12 - tubes 1-9.
The restriction enzyme digest was performed and a gel was ran to see the results. In the gel (Fig. 1) it is clear that there is a lot of contamination and it is not clear if the three bands are present or four. In order to see if there was contamination came from the original samples or the enzymes, another gel was ran with just the samples and no enzyme in them. From the gel it is visible that the enzymes nor the samples did not contain contamination. Hence it is not clear from the restriction enzyme digest if the cloning worked or not. To determine if the cloning worked, the DNA sequences will have to be analyzed.
Master Plate and Mini-prep of pNIC with RpFabG (7/19/2013)
Since the first transformation was successful at producing colonies, they were used to make a master plate and start overnight cultures. The master plate, once it was made, was incubates overnight in the incubator and the overnight cultures were placed in the shaker overnight. The next day the master plate was checked for growth and it was found that there were colonies growing as they should be. The cultures were then spun down and the pellets were used for mini-prep. After mini-prep was done, the samples were nanodropped and then sent off to sequencing. All of the tubes (1-9) were sequenced with pLIC-For and then the tubes with the top three concentrations were sequenced with pLIC-Rev.Figure 1. This table shows the first and second sample concentrations of each tube, the average concentration of the sample, the average 260/280 values, and the average 260/230 values.
Fifth Round of Cloning of RpFabG in pNIC-Bsa4 (7/17/2013)
Due to the previous four failed rounds of cloning, yet another round of cloning was performed. This time after further discussion with mentors and Dr. Beckham, it was decided that a 1:8 ratio of vector to insert would be used and that the times of the procedure for annealing and transforming would be doubled. The PCR insert and cut pNIC that were prepared previously were used again for this round too. Tube A was prepared like always but this time, like mentioned previously, tube B was made with 1 uL of vector and 8 uL of insert. The room temperature incubation step time was doubled to 20 minutes, after the DH5 alpha cells were added, the mixture was iced for 1 hour, followed by a heat shock for 1.5 minutes. The remaining of the steps was done as stated in the protocol. The plates were incubated overnight and the next day were checked for growth. Finally, it was found that the plates had colonies and hence cloning was successful.Figure 1. On the left is the plate with the content from tube A and on the right is the plate with the content from plate B. It is visible that there are few colonies growing on the plate, so they were used for the remaining of the cloning procedure.
Fourth Round of Cloning of RpFabG in pNIC-Bsa4 (7/16/2013)
Again since the first three rounds of cloning were unsuccessful at producing colonies another attempt of cloning was done. This time the higher concentration pNIC-Bsa4 was used and the higher concentration PCR squared product. Both were prepared with cohesive ends and then annealing and transformation was started. On this round, tube A remained the same as in all previous rounds, but again tube B was changed to 9 uL of vector and 12 uL of insert. The procedure was performed exactly as before, and the plates were incubated overnight. On the next day, the plates were checked for colony growth and none was found again.Figure 1. The plate on the left is plate A which contains the content from tube A (2uL of vector and 4uL of insert). On the right is plate B which contains the content from tube B (9 uL of vector and 12 uL of insert). It is clear that there are no colonies growing on the plates, hence the cloning was again unsuccessful.
Week 6:
Oscar - show your PCR results (overlap, PCRsquared) - Dr. B 071713Restriction Enzyme Digest of pNIC-Bsa4 Round 3 (7/12/2013)
After the third failed round of cloning, the concentration of pNIC was again tried to be increased in hopes that it would lead to a successful cloning. Again, after consulting with Dr. Beckham, it was determined that it would be best to prepare four tubes of pNIC in the R.E. digest and then PCR clean them together to achieve a higher concentration. The 50 uL final volume for the digest was still used and the four tubes were made after which they were cleaned into one sample. The sample was then nanodropped to determine the concentration. The higher pNIC concentration was finally achieved.Figure 1. This is the first of two reading to determine the average concentration of the sample. It was found that the average concentration was 198.9 ng/uL, the average 260/280 value was 1.865 and the average 260/230 value was 2.345.
Third Round of Cloning of RpFabG in pNIC-Bsa4 (7/12/2013)
Since the second round of cloning failed to produce any colonies, a third round of cloning was performed. In this round the PCR insert came from the second round preparation and the pNIC from the second round were used. The only other thing that changed is that tube B contained 9 uL of vector and 16 uL of insert. All other steps were followed exactly as before. The plates were eventually incubated overnight and checked the next day. On the 13th the plates were checked and there were no colonies again on the plates.Figure 1. The plate on the left shows the plate with the content from tube B (9 uL of pNIC and 16 uL of PCR insert) and on the right is the plate with the content from tube A (2 uL of pNIC and 4 uL of insert). Again there are no colonies visible.
Second Round of PCR squared Preparation (7/12/2013)
Since two round of cloning were performed, all of the PCR insert that was prepared was used up and so more had to be made. Using the remaining secondary PCR product, another round of PCR squared was performed and then cleaned with a PCR clean up kit. The sample was then nanodropped to determine the concentration of this sample.Figure 1. This is the first sample of two to determine the average concentration of the sample. The average concentration was found to be 251.1 ng/uL, the average 260/280 value was 1.865 and the average 260/230 value was 2.34.
Second Round of RpFabG in pNIC-Bsa4 Cloning (7/12/2013)
Since the first round of cloning failed to produce any colonies, a second round was performed. Since there was still accepting vector and PCR insert from the previous round, they were used for this round. Tube A contained the same rations as last time, but tube B had 3 uL of accepting vector and 4 uL of insert, everything else was kept the same. The plates were checked the next day (7/13/2013) and it was found that there were no colonies either.Figure 1. In the figure plate A (on left) contains the content from tube A, 2 uL of accepting vector and 4 uL of PCR insert. The plate on the right is plate with the content of tube B, 3 uL of vector and 4 uL of PCR insert. It is clear that there are no colonies growing on the plates.
Rerun of pNIC-Bsa4 DNA Sequence Results (7/11/2013)
The Core reran the sample of pNIC-Bsa4 that was submitted the second time, and the resulting sequence is shown below.
NNNNNNNNNNNNNTTNNNNNNNNNNNACATATGCACCATCATCATCATCATTCTTCTGG
TGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGAGACCGACGTCCACATA
TACCTGCCGTTCACTATTATTTAGTGAAATGAGATATTATGATATTTTCTGAATTGTGAT
TAAAAAGGCAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATGAAAA
GAAACAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGATTTTC
TATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGA
GGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATGT
GTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTTATT
GTGCGTAACTAACTTGCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACA
CAGTACATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAAGCAAC
AGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGCGTTTGCGAAAG
AAACGANCCAAAAAGCCATATAAGGAAACATACGGCATTTCCCATATTACACGCCATGAT
ATGCTGCAAATCCCTGAACAGCAAAAAAATGAAANTATAAAAGTTCCTGAGTTCGATTCG
TCCACAATTANANTATCTCTTCTGCAAAGGCCTGGNNGTNNGNGANNNNNNNNCNTTANN
ANANNCTGACNNNCTGTCGNNNNNATCACNGNTACCACNTCGNCNTTGCATTANNCNNNN
TNCTAANANNGCNNNNNNNNNN
Using this new sequence, a BLAST was performed against the known databank to see what would result. It turned out that the sequence was not an 83% match to pNIC28-Bsa4 but a 99% match. To further test the match, a BLAST alignment was also done on the obtained sequence and the known sequence of pNIC-Bsa4. It resulted the same as the first BLAST, indicating that it was also a 99% match to pNIC-Bsa4.
Figure 1. A BLAST was conducted with the resulting DNA sequence against all of the NCBI database to see what it was the most similar to. It showed that the sequence was an almost perfect match to expression vector pNIC28-Bsa4.
Figure 2. Furthermore, a BLAST alignment was also conducted using the sequence from the core and the known sequence of pNIC-Bsa4. It also resulted in a 99% match.
These results indicate that the first read was just a bad read, and that the pNIC-Bsa4 that was obtained from the Midi-prep is more than suitable for cloning of RpFabG.
Second Round of R.E. Digest of pNIC-Bsa4 (7/10/2013)
Due to the failure of the cloning, it was suspected that the low concentration of pNIC was the issue. In hopes to change this, the pNIC concentration was attempted to be increased. After speaking to Dr. Beckham, it was determined that the final volume of the RE Digest of pNIC should be increased to 50 uL thus allowing for a full 2.25 ng of plasmid to be added. This was done and the pNIC was then PCR cleaned up and then nanodroped to find the concentration.Figure 1. This is the first of two reads of the concentration of the pNIC, the concentration was 49.2 ng/uL, it is clear that the concentration has increased from the first round, though it is still not in the desired range. The average concentration of the sample was 48.85 ng/uL, the 260/280 value was 1.795 and the average 260/230 value was 2.015 ng/uL.
First Cloning of RpFabG in pNIC-Bsa4 Results (7/10/2013)
Cloning was finally started, which involves the cohesive end generation of the cut pNIC-Bsa4 and the PCR squared cleaned product, annealing and then transformation. The protocol was followed in order to produce the cohesive ends on the insert and the vector which prepares them to be joined together. After they were ready two separate tubes were made, tube A with 2 uL of vector and 4 uL of insert, and tube B with 3 uL of both insert and vector. The mixture was then iced and heat shocked followed by adding SOC for the bacteria to grown. The mixture was then plated on kanamycin and sucrose plates and incubated overnight. The next day the plates were checked for any colony growth but it was found that there were no colonies growing.Figure 1. On the left is plate A which has the content from tube A (2 uL of vector and 4 uL of insert) and on the right is the plate with the content of tube B (3 uL of insert and 3 uL of vector).
RE Digest of pNIC-Bsa4 with BsaI (7/10/2013)
In order to determine if the pNIC-Bsa4 that was used for the cloning was cut correctly by the BsaI, a virtual digest was done in order to see what the results should look like. A virtual gel was obtained with a 1 kb DNA ladder in order to compare actual gel results.
Figure 1. NEB cutter was used to perform a custom digest with the restriction enzyme BsaI. A virtual gel was also obtained of this digest in order to compare results of actual gel. Two bands should be visible, one between 6 and 5 kbps and one at 2 kbps.
Figure 2. A 1.3% agarose gel was made with lane 3 containing the 1 kb DNA Ladder and lane 4 containing the cut pNIC-Bsa4 sample. It is clear that there is one band between the 5 and 6 kbp band and anther band at the 2000 bps band. This indicates that the pNIC-Bsa4 was cut correctly at the appropriate places and was ready for cloning.
Sequencing Results of Second pNIC-Bsa4 (7/9/2013)
NNNNNNNNNNNNNNNNNNGNNNNNNGNGGAGATATNCATGTGCNCCGTCNNCNTNNNNGTTCNNNN
GGTGNANATCTGGNTNCCNANAACNNGNATTTCCAATCNNTGGNNNCCGACGTCCACATATACCTGC
CGTTCANTATTATTNNNNGAAATGANATATTATNANNTTTTCTGAATTGTGATTAANANAGCAACTTNA
TNNCCANNCNACNNAANCTATAAAAAATATTGANAATGAAAGGAAACANANAGANTTTTTNNTTCTTT
ANGCCCCTAGTCTGCATATCCTTTTATGATTTTCTATCAAACAAAAGAGGAAAATCNGNNNGGTGCAA
NCNAAACGAGAGTCTAATAGAATGAGGNCNAAAANNAANTCNNNNGGGTTTGTTACTGATANNNCAG
GCANGACCTAAAATGTGTCAAGGGCAAAGTGTATACTTTGGCGTCGCCCCTTGCNNNNTNNNCGNCT
TNTTNNNTTGNGNNNNACNNNCNTGCNATCTTCNNGCNGGAGGGCTGGANNAAGNNGACCNCTNANN
CGNNACATANNNNNNGANACATGNNNGANNAACNTCANNNNGNTTGNNNNNNNNNNNNNNTNTTAAN
NNTNACNACCGCACTGCTGGCNNGAGGCNNNNNNCNNNCNTTNGCNNCAGAANCNNNGCNNANNNNC
TATAANGANACATNCNGCTTTNNNNNNNTNACACNCNANGAGATGCTGCANATCCCTGANCNNCNNNC
ANANNNNNAANGTNANGNNNCTGANTTNNANTCNTCGACAATTANNNATNTCTCTNCNGCNANANGCC
TNNNNGATTNNNNNNNCTGNCCATNCTCANNNCNNGACGGCTCTGTCTCNNNNTANNNCGNTNNCNCC
NTGGNTNNTTTCNNTGNNCNNACATCCTANTAATNCCNACGNNNCGNCNATTCNNNNTTCTNNNNANG
GGCNGNGNANNTTCNACNGANTNNNCNNNNNNCTGGCNCNNNNTTAANNANTNNNNANNNNNNNNCT
ANNAGNGCTCCNANTNNNCNNNNNNTGGCATGNNNCGGNTCNNCANANNNNNNNNNTNGGNAAAAAN
NNNGNNNTANTNNNTTNCTTTCNNNNNGANNTNNN
Using the DNA sequence, a BLAST was conducted against all the known database and it resulted with a 83% match to pNIC28-Bsa4. Additionally, a BLAST was conducted with the known sequence of pNIC-Bsa4 and again an 83% match resulted.
Figure 1. A BLAST was ran with the resulting DNA sequence from the core, against all of the known database. It showed that the sample DNA was an 83% match to pNIC28-Bsa4.
Figure 2. Additionally, a BLAST sequence alignment was performed against the known sequence of pNIC-Bsa4. Again, it resulted in an 83% match to the known sequence of pNIC-Bsa4.
After some analysis, it was determined that the DNA sequence was a bad read and that it would be best to resubmit to DNA sequencing. Interestingly, the CORE emailed saying that they have had some bad DNA sequencing results lately and that they will be re-running my sample and results will be available on the 11th.
Preparation of pNIC-Bsa4 for Cloning (7/8/2013)
The pNIC-Bsa4 that was purified from the overnight culture with midi-prep was digested with the restriction enzyme BsaI in order to prepare it for cloning.
Figure 1. The first measurement of the cut pNIC-Bsa1 showed that the concentration was 28 ng/uL, the 260/280 value was 2.03 and the 260/230 value was 2.29. This indicates that the sample is relatively pure relative to proteins and other contaminants, and has a good yield.
Figure 2. The second measurement of the cut pNIC-Bsa1 showed that the concentration was 25 ng/uL, the 260/280 value was 2.23 and the 260/230 value was 2.24. This indicates that the sample is relatively pure relative to proteins and other contaminants, and has a good yield.
The average concentration of the sample was 26.5 ng/uL, the average 260/280 value was 2.13, and the average 260/230 value was 2.265. The sample is now ready for cloning of RpFabG into the pNIC-Bsa4 plasmid.
Week 5:
Midi-Prep of pNIC-Bsa4 Round 2 (7/6/2013)
From the second round of Midi-Prep of pNIC-Bsa4, it was determined that the average concentration of the sample was about 61.95 ng/uL, the average 260/280 value was 1.955 and the average 260/280 value was 25.36. This shows a better yield then the first round of Midi-Prep, but a worse purity then before.
Figure 1. This first measurement of the pNIC-Bsa4 sample shows that the concentration is 61.3 ng/uL, the 260/280 value was 1.94 and the 260/230 value was 28.04.
Figure 2. This is the second measurement of the pNIC-Bsa4 sample that shows that the concentration was 62.6 ng/uL, the 260/280 value was 1.97, and the 260/280 value was 22.68.
Nanodrop of RpFabG PCR After Clean Up (7/6/2013)
From the successful secondary PCR, a PCR squared was conducted and the resulting PCR sample was purified using a Sigma PCR clean up kit. The resulting sample was Nanodroped to determine the concentration and purity. The average concentration was determined to be 176.1 ng/uL, the average 260/280 value was 1.815 and the average 260/230 value was 2.23. This indicates that the sample was pure relative to protein and other contaminates and had a good yield.
Figure 1. The first sample measurement of the RpFabG from the PCR clean up kit showed that the concentration was 177.4 ng/uL, the 260/280 value was 1.79 and the 260/230 value was 2.16.
Figure 2. The second sample measurement from the RpFabG sample after the PCR clean up kit was used to purify the PCR squared results. This shows that the concentration was 174.8 ng/uL, the 280/260 value was 1.84, and the 260/230 value was 2.30.
RpFabG PCR Primer Overlap [Secondary PCR Option B] (7/5/2013)
Figure 1. Lane 4 contains a 1 kb DNA Ladder and lane 5 has the sample from the secondary PCR done with option B (using the tail primers). It should be noted that when the agarose gel was made a mistake was made and the gel wells did not form correctly, most wells had bubbles and were collapsed. The two best lanes were used to run the sample. It is evident that the ladder did not run properly, but it can still be seen where each band is on the ladder. The sample of the PCR though ran perfectly, and is located in the right size (between the 1 kbp band and the 0.5 kbp band). Hence, the secondary PCR was successful.
pNIC-Bsa4 DNA Sequencing Results (7/5/2013)
DNA sequence result were obtained from the Core and analyzed to determine if the sample contains the correct plasmid.
DNA Sequence Results:
NNNNNNNNTNGNNNACTTTAGNNGAGANATACATATGCACCATCATCA
TCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCA
ATCCATGGAGACCGACGTCCACATATACCTGCCGTTCACTATTATTTAG
TGAAATGAGATATTATGATATTTTCTGAATTGTGATTAAAAAGGCAACT
TTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATGAAAAGAAA
CAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATG
ATTTTCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGA
GAGTCTAATAGAATGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTG
ATAAAGCAGGCAAGACCTAAAATGTGTAAAGGGCAAAGTGTATACTTTG
GCGTCACCCCTTACATATTTTAGGTCTTTTTTTATTGTGCGTAACTAACTT
GCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACACAGTA
CATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAA
GCAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTC
AAGCGTTTGCGAAAGAAACGAACCAAAAGCCATATAAGGAAACATACGG
CATTTCCCATATTACACGCCATGATATGCTGCAAATCCCTGAACAGCAAA
AAAATGAAAAATATAAAGTTCCTGAGTTCGATTCGTCCACAATTAAAAAT
ATCTCTTCTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCATTACAAA
ACACTGACGGCACTGTCGCAAACTATCACGGCTACCACATCGTCTTTGC
ATTAGCCGGAGATCCTAAAAATGCGGATGACACATCGATTTACATGTTC
TATCAAAAAGTCGGCGAAACTTCTATTGACAGCTGGAAAAACGCTGGGC
CGCGTCTTTAAAGACAGCGACAAATTCGATGCAAATGATTCTATCCTAAA
NACNNAACACNAGAANTGGNCAGGNTCAGCCNCATTTNCNTCTGACGNA
AAAANCNNTNATTCNACACTGATTNCNNNGNAANNNTNNNNNNNAANNNN
NGANNNCTGNNNNANNNNNNNTCANCATCNNANNNNTCTTNANCNNNNNC
GNNNNNNNNNNNNANNNNNNNNTTNACNNNNNNNNNNNNNNNNNNANNNN
NNNNCNNNNNNNNNNNNNNGNNANNNNNNGGNNNNNGGGNNNNANNNN
A BLAST was then conducted to see if the sequence was similar to any other known sequences. From the results (shown below) it can be seen that there is an 98% match to expression vector pNIC28-Bsa4, complete sequence. Just to further conclude that the sequence was a match for pNIC-Bsa4, an alignment BLAST was done.
Figure 1. The BLAST of the obtained sequence against all known sequences. It shows that there is a 98% match to the expression vector pNIC28-Bsa4, complete sequence.
The alignment BLAST (shown below) also resulted in a 98% match to the known sequence of pNIC-Bsa4. Hence, the sample that was obtained from the Midi-Prep did result in pNIC-Bsa4 plasmid, but from the Nanodrop it was evident that the sample was not pure, so a second Midi-prep was done in hopes to better the yield and purity.
Midi-Prep of pNIC-Bsa4 (7/3/2013)
An overnight culture was started of pNIC-Bsa4 in 160 mL of LB media, the culture was then centrifuged and the pellet that was obtained was used for the Midi-prep. Once the Midi-Prep was complete, Nanodrop was used to determine the concentration of the resulting plasmid. A sample was also submitted to DNA sequencing to ensure that the correct plasmid was extracted into the sample.
Figure 1. The first sample of the pNIC-Bsa4 shows that the concentration is 40.4 ng/uL, the 260/280 value is 2.01, and the 260/230 value is 14.09. The 260/280 value, which indicated the contamination relative to other protein, was at an acceptable range and indicates a pure sample. On the other hand, the 260/230 value which indicates the contamination relative to other contaminates, is 14.09 which is extremely high. To make sure that the sample is good, it was submitted to DNA sequencing.
Figure 2. The second sample of the pNIC-Bsa4 shows a concentration of 39.6 ng/uL, a 260/280 value of 1.99, and a 260/230 value of 12.54. The 260/280 value is again in a good range and indicates that the sample doesn't have much protein contamination. But yet again, the 260/230 value is 12.54 and is very high and is indicative of a lot of contamination.
RpFabG Overlap PCR (7/3/2013)
Targets were assigned on monday and it was determined that I will be working on FabG 3-ketoacyl-(acyl-carrier-protein) reductase (RpFabG). It should be noted that the RpFabG gene contains 726 bp's and will be placed into a pNIC-Bsa4 accepting vector, of about 5358 bp's. To start on the target work, an overlapping PCR was started, consisting of a primary and secondary PCR, eventually followed by a PCR squared. Below are the results from the first two PCRs.
Figure 1. Lane 1 through lane 4 belong to Melissa H. lanes 5 through 7 belong to Oscar V.. Lane 5 contains a 1 kb DNA Ladder, lane 6 has the sample from the primary PCR, and lane 7 had the secondary PCR. Lane 6 shows the smear that indicates that the first PCR worked and lane 7 shows a band somewhere between the 1000 bp and 500 bp bands on the ladder, which is ideal since the gene is about 700 bp long. Thus the PCR worked well and PCR squared can be started.
Restriction Enzyme Digest (7/2/2013)
Due to the fact that the first restriction enzyme digest did not work properly, which was though to have been cause by contaminated pGBR22, a second restriction enzyme digest was ran. To ensure that the results from the first RE digest were due to the contaminated pGBR22, an uncut plasmid sample from the first trail was ran along with the new samples. The results are good and show proper plasmid sizes, which are similar to the virtual gel that was previously completed.
Figure 1. Lane 1 contains the 1 kb DNA Ladder, lane 2 contains the sample from the uncut plasmid that was used for the digest, lane 3 has the plasmid with the EcoRI enzyme, lane 4 has the plasmid along with the PvuII enzyme, lane 5 contains the plasmid and both EcoRI and PvuII enzymes, and lastly lane 6 has the uncut plasmid sample from the past RE digest. It is interesting that the shape of the resulting bands is not the typical rectangle but a U-shape. Lane 2 shows the uncut pGBR22 plasmid but has some contamination. Lanes 3 and 4 have good signal and are the appropriate sizes, which is determined from the virtual gel that was previously ran. Lane 5 has two very clear bands, but the third band is not very visible since its signal is weak, but it can be seen. And finally, it was determined that the plasmid that was used for the first RE Digest was not contaminated and that the three bands that are visible are normal.Protein Characterization (7/2/2013)
Figure 1. The completed protein gel of the FtHap in pNic-Bsa4 is shown above with lane 0 being the protein ladder, lane 1 being the sample from the cell lysate before induction, lane 2 is the sample from the cell lysate after induction, lane 3 is the sample from soluble fraction, lane 4 being the sample from the flow through, lane 5 is the wash sample, lane 6 is the sample from elution 1 and lane 7 is the sample from elution 2. Unfortunately, while running the gel we had substantial "smiling" of the gel thus creating the normal curve at the bottom of the gel. Nevertheless, the results are pretty good since there isn't much contamination in lane 6 (there is a clear band as there should be) and the other lanes look as they should also.
Primer Design (7/1/2013)
Tail primers, forward and reverse, for Dihydrofolate reductase - thymidylate synthase were made and ordered for individual projectForward Primer:
5’ - TACTTCCAATCCATGCTCTCCCTGACGCGCATT-3’ 33 bpGC Content 51.5_%
0 mM Mg2+ Tm 66.5_ oC 1.5 mM Mg2+ Tm _73.6_ oC 2 mM Mg2+ Tm _74.0 oC
4 mM Mg2+ Tm _74.7 oC 6 mM Mg2+ Tm _75.1__ oC
Reverse Primer:
5’-CTCTATGGAAATGGCGGTGTAACAGTAAAGGTGGATA-3’Reverse complement it:
5’-TATCCACCTTTACTGTTACACCGCCATTTCCATAGAG-3’ 37 bp
GC Content _43.2%
0 mM Mg2+ Tm _62.8 oC 1.5 mM Mg2+ Tm _70.5 oC 2 mM Mg2+ Tm _71.6_ oC
4 mM Mg2+ Tm _72.4 oC 6 mM Mg2+ Tm _72.8__ oC
Figure 1. A custom digest of pNIC-Bsa4 was conducted using the restriction enzyme BsaI. The sites where the enzyme would cut the pNIC plasmid are depicted above.
Week 4:
Restriction Enzyme Digest (6/28/2013)
Figure 1. The above shows the gel obtained from running the restriction enzyme digest on an agarose gel. In lane one a 1 kb DNA ladder was placed, in lane 2 there is a sample of pure pGBR22 plasmid, lane 3 has the EcoRI enzyme, lane 4 has PvuII enzyme, and lane 5 has EcoRI and PvuII enzymes. It is apparent that none of the samples worked correctly. Lane 2 should only show one band in the 400 bp range and instead shows three bands that are too big to be pGBR22. This is likely due to contamination. In order to better understand this, further test will be conducted and the restriction enzyme digest will be done again with a different sample of pGBR22 plasmid.
Protein Characterization (6/28/2013)
Results will be posted in week 5 since the gel is destaining over the weekend.
Protein Purification (6/26/2013)
Using the pellet that was obtained from protein expression, sonication, and the spin-down, the protein was purified and several samples were collected. From the first and second elution that were collected from the purification, nanodrop was used to determine their absorbance at 280 nm. The results are shown bellow.
Figure 1. This is the result from elution 1. It shows that the average absorbance is 0.0835 and the 260/280 value was 1.105.
Figure 2. This is the results from the nanodrop of elution 2. The average absorbance was 0.022 and the average 260/280 value was 0.1.
The E value of the protein was determined to be 53290, the concentration of elution 1 was 1.57 uM, the concentration of the second elution was 0.41 uM, the yield of the first elution was found to be 7.85 mg, and the yield of elution 2 was 2.05 mg.
DNA Analysis (6/24/2013)
Figure 1. This shows the BLAST results when the obtained pGBR22 sequence was ran against the human genome. It is evident that there was not a match.
Figure 2. Next a BLAST was ran against all other genomes to see any posible matches. The results show that there is a 99.9% match to monopora efforescens GFP-like chromoprotein mRNA complete cds.
A comparison was conducted between the known DNA sequence of pGBR22 and the obtained sequence from the Core. The results show that the sequences were a 99.9% match. The sequence only had 1 mismatch where a G was replaced with an A. (BLAST pictured below)
Query 1 ATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 105 ATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGA 164
Query 61 CACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 165 CACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTA 224
Query 121 AAGCTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 225 AAGCTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTG 284
Query 181 TCTCAATACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGATTATGTAAAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 285 TCTCAATACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGATTATGTAAAG 344
Query 241 CAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 345 CAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTG 404
Query 301 TGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 405 TGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATC 464
Query 361 TCTGGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 465 TCTGGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAA 524
Query 421 CCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGATAGGAAACAACTTTATGGCT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 525 CCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGATAGGAAACAACTTTATGGCT 584
Query 481 CTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAGTTCAAATCTACTTACAAGGCAAAG 540
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct 585 CTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAATTCAAATCTACTTACAAGGCAAAG 644
Query 541 AAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCAC 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 645 AAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCAC 704
Query 601 AACAAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTC 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 705 AACAAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTC 764
Query 661 GGTCATCACCATCACCATCACTAA 684
||||||||||||||||||||||||
Sbjct 765 GGTCATCACCATCACCATCACTAA 788
The sequence was then translated into its protein sequence, and then ORF Finder was used to find the correct reading frame. It was determined that the third reading option, the second frame in the forward direction, was the correct reading frame for the sequence.
An enzyme digest was conducted virtually using the completed pGBR22 plasmid, for the first trail EcoRI was used, for the second PuvII was used, and the third used both EcoRI and PuvII. The virtual gel that was obtained is depicted below.
Week 3:
Protein Expression (6/19/2013)
Protein expression was conducted using FtHap in pNIC-Bsa4. The OD600 value of the culture was monitored using a spectrophotometer until it had reached 0.1. The following is the log of the results.
Verification of pGBR22 Plasmid (6/18/2013)
Figure 1. After the BLAST was conducted, it was determined that the plasmid that was submitted was 100% match to pGBR22. Hence, the sample was moved to verified plasmid box.
Agarose Gel of pNIC with pLIC Primers (6/17/2013)
Figure 1. This agarose gel shows the result of the first trial of the PCR of pNIC plasmid using pLIC forward and reverse primers. In lane 1 there is a 1 kb DNA ladder, in lane 2 the low concentration sample was ran, the medium concentration sample is in lane 3, the high concentration sample is in lane 4, and the control with no DNA template is in the 5th lane. It is evident that the gel did not run very well since the ladder didn't even show up correctly. But there is a band in lane 2 and 4 that show successful amplification of the plasmid. Since the 4th lane has a higher concentration, it is expected that it has more amplification and a stronger signal, and this is seen in the gel.
Week 2:
Agarose Gel of pmCHERRY (6/14/2013)
Figure 1. This is the agarose gel for the second trial of the pmCHERRY plasmid. Lane 1 has the 100kb DNA ladder, lane 2 has sample 1, lane 3 has sample 2, lane 4 contains the sample from 3, lane 5 the 4th sample, lane 6 has the 5th sample, lane 7 has sample 6, lane 8 has sample 7, lane 9 has sample 8, and lane 10 has sample 1 from the previous PCR trail (which the gel failed for). It is evident that there is a signal from lanes 3 and 4, which contain the higher concentrations of the DNA template and has VDSR1 and VDSR2 primers. This probably indicates that the PCR for the VDSR primers was successful, but the PCR for the M13 primers was not, since there is no signal from any of its lanes. The anneal temperature for the PCR of the M13 primers was probably set at the wrong temperature and thus caused the PCR to be unsuccessful. Also, lane 10 has no signal, which could be due to the fact that only 5 uL of the sample were used or because the previous PCR failed the first time.
Figure 2. The gel of the pmCHERRY. Lane 1 is empty, Lane 2 contains sample 8, lane 3 contains sample 7, lane 4 has the sample from 6, lane 5 has the sample from 5, lane 6 has the sample from 4, lane 7 has the sample from 3, lane 8 has the sample from 2, lane 9 has the sample from 1, and lane 10 has the 1 kb DNA ladder. It is evident that there is no signal from the DNA in the gel. This is most likely due to the fact that the buffer was confused when the gel was ran and ended up being ran with 1xTBE instead 1xTAE. The plasmid PCR will be redone and another agarose gel will be done.
Midi-Prep (6/12/2013)
The sample of the DNA that was obtained from the midi prep kit had an average concentration of 180.7 ng/uL
and from the Nanodrop values it seems that the sample does not contain many contaminants. In order to
ensure that the DNA that was obtained is the wanted DNA with the pGBR22 gene, the DNA sample was
submitted to DNA sequencing. Below are the Nanodrop images that were obtained from the two measurements
in order to determine the concentration of the sample.
DNA Sequence Result:
NNNNNNNNNNNNNGGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTTTAGTGAT
GGTGATGGTGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACAAATGTGTAATCCTT
GTTGTGACTGGTTACATCCAGTTTGCGGTCAACATAGTGATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGT
AAGTAGATTTGAATTCACACAAATAGTAACCACCTCCTTCCAACTTCAGAGCCATAAAGTTGTTTCCTATCAGCA
TTCCATCTCGTGCAAAGAGACGCTCAGTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTG
GGAGGAAAGTTCACACCAGAGATTTTGACATTGTAGATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGAC
AGTACACACTGCACCATCTTCAAAGTTCATGATCCTCTCCCATGTATATCCCTCAGGGAATGACTGCTTTACATA
ATCAGGGATGTCTTCAGGGTACTTGGTGAATGGTATGCTTCCGTATTGAGACAGTGGTGATAAAATATCCCAAG
CAAATGGCAGAGGTCCACCCTTGGTGACAGTGAGCTTTACCGTCTGCTCCCCCTCGTAAGGCTTTCCTTTTCCAT
CGCCTTCGACCTCAAAGTAGTGTCCATTGACCGTGCCTGACATATAAACCTTGTAGGTCATTTGTTTAGCGATCA
CACTCATGATATTTCTCCTTCAATCAATCAAAATCACTAGTGCGGCCGCCTGCNNTCGACCATATGGGAGAGCTC
CCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACNAGCCGGAAGCATAAAGTGTAAAGCCTGG
GGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAANNCTGTCG
TGNCAGCTGCATNANGANCGGCNANNNNNNNGGNAGAGNNNTTGCGTNTGGGCGCTCNTCNCNNCCTCNCTCAN
NGANTCNCNNNNNNNGNNNNNGNNGNNNNNNNNNNNTCANNNNNNNTCNANNNNNNNNNNNNNNCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNGANNNNAAANNNNCNNNTNNNNNGNN
Nanodrop Results:
Figure 1. This is the result after the midi prep kit was used on the overnight E.coli culture, that was transformedwith the pGBR22 gene, to extract the transformed DNA plasmid from the E.coli bacterial cells. The resulting
DNA concentration was then measured using Nanodrop. From the first measurement, the resulting concentration
was found to be 171.5 ng/uL, the 260/280 value was 1.93 and the 260/230 value was 2.4. The 260/280 value (ideally 1.8)
indicates that the sample had a good purity relative to protein, and the 260/230 value (ideally 2.1) indicates that
the sample was relatively pure relative to contaminates. Thus, the sample had a good yield.
Figure 2. This is the result after the midi prep kit was used on the overnight E.coli culture, that was transformed
with the pGBR22 gene, to extract the transformed DNA plasmid from the E.coli bacterial cells. The resulting
DNA concentration was then measured using Nanodrop. From the second measurement, the resulting concentration
was found to be 189.9 ng/uL, the 260/280 value was 1.90 and the 260/230 value was 2.63. The 260/280 value (ideally 1.8)
indicates that the sample had a good purity relative to protein, and the 260/230 value (ideally 2.1) indicates that
the sample was relatively pure relative to contaminates. Thus, the sample had a very good yield.
Agarose Gel of PCR Plasmid (6/11/2013)
Figure 1. The agarose gel contains a 1kb DNA Ladder (the left well), lane 2 has the content from tube A from the PCR,
lane 3 has the content of tube B, the 4th lane has the content from tube C, and the 5th lane has the content of tube D.
It is evident that there is no signal from lane 2 which must be due to an error in the PCR, and there is also no signal from
the 5th lane, but thats due to the fact that tube D had no plasmid so it's not suppose to have a signal. Lane 3 and 4 have a
weak signal but do show up a little in the UV light.
Transformation Efficiency (6/10/2013)
Figure 1. This plate shows the content from tube C, which contained the LB, ampacilin, and pGBR22. Tube C only contained
25 ng of the plasmid. After incubation, the plate resulted to have about 4188 colonies, indicating that the efficiency was 167.52
colonies per ng of plasmid.
Figure 2. This plate shows the content from tube B, which contained the LB, ampacilin, and pGBR22. Tube B only contained
5 ng of the plasmid. After incubation, the plate resulted to have about 676 colonies, indicating that the efficiency was about
135.2 colonies per ng of plasmid.
Figure 3. This plate shows the content from tube A, which contained the LB, ampacilin, and pGBR22. Tube A contained
1 ng of the plasmid. After incubation, the plate showed no colonies, which could mean that there was either an efficiency
of 0 colonies per ng of plasmid or that something went wrong which lead to the lack of colony growth.
Week 1:
Nanodrop Spectrophotometer (6/4/2013)
Figure 1. The above figure is a screenshot of the result of the first round of measurements of the pGBR22. It showed that the concentration was 191.5 ng/uL, furthermore indicating that the concentration is approximately 0.1915 ug/ul. The 260/280 value, which is the purity of the DNA in relation to protein, was 1.93 which ideally would be around 1.8, indicating that the DNA was relatively pure in the sample. The 260/230 value, which indicated the purity of the DNA relative to other contaminants, was 2.73. The 260/230 value should ideally be around 2.1, showing that the sample was not very pure and had several contaminants.
Figure 2. The above figure is a screenshot of the result of the second round of measurements of pGBR22. It showed that the concentration was 189.9 ng/uL, furthermore indicating that the concentration is approximately 0.1899 ug/ul. The 260/280 value was 1.90 indicating that the DNA was relatively pure even a little more than sample one. The 260/230 value was 2.63, showing that the sample was not very pure and had several contaminants but was a little more pure than the first sample.
DNA Sequencing (6/4/2013)
DNA plasmid: pGBR22
DNA sequence result:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACNTCNNATGCTCCCGGCCNCCNTGGCCGCNGGATTTTAGTGATGGTGATGGTGATGACCGAN
CAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACAAATGTGTAATCCTTGTTGTGACTGGTTACATCCAGTTTGCGGTCAACATAGTGATACCCTGG
CATCCTCACAGGCTTCTTTGCCTTGTAAGTAGATTTGAATTCACACAAATAGTAACCACCTCCTTCCAACTTCAGAGCCATAAAGTTGTTTCCTATCAGCATTC
CATCTCGTGCAAAGAGACGCTCAGTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGGAAAGTTCACACCAGAGATTTTGACAT
TGTANATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGACAGTACACACTGCACCATCTTCAAAGTTCATGATCCTCTCCCATGTATATCCCTCAGGGAA
TGACTGCTTTACATAATCAGGGATGTCTTCAGGGTACTTGGTGAATGGTATGCTTCCGTATTGAGACANTGGTGATAAAATATCCCAANCAAATGGCANAGG
TCCACCCTTGGTGACAGTGAGCTTTACCGTCTGCTCCCCCTCGTAAGGCTTTCCTTTTCCATCGCCTTCNACCTCAAAGTANTGTCCATTGACCGTGCCTGAN
ATATAAACCTTGTAGGTCATTTGTTTAGCGATCACACTCNTGATATTTCTCCTTCANNCAATCANAATCACTANTGCGGCCGCCTGCNNTCGANCATATGNGAG
AGCTCCNAANGCGTTGGATGCATANCTTGAGTATTCNATAGTGTCACCTAAATAGCTTGGCGTAAATCNTGGTCATAGCTGTTTCCNGNNGTGANATTGNTAT
CNNCNNCACAATCCNCNCCANATACNAGNCCGGANCATAANNNGTANNGCCTGNGGTGNCTAANGACTGAGCTACNNNATTANNTNNNNTGNNNNTCNNTGN
CCGCNTTCAGTNNGNAANCTGGTNNNNNNNNCNNNAATNATNNANTCNNCNNNNNN